Custom Service
DNA sequencing
|
DNA sequencing
Favorgen Research has already been proofed their advanced skills and techniques in the areas of biotechnology, genetic engineering and molecular biology. Bulk orders (96-well plates formatted):
The price will be going down depending on the amount of plates.
These samples will be formatted into each well of the plates as follow:
Add 4ul of template DNA, 150ng-160ng/ul, must be correct concentration!!!
Add 2ul of 2.5-5uMole of a primer.
Total volume in each well is 6ul, then seal the plates tightly with strip caps or very thick gel heat-sealer films.
Note: In the sky when air-shipping, the air pressure will be reduced, leaking out and under the film will make samples lost and contaminations between wells.
High through-put capillary sequencers
Read more than 900 bases.
-
Turn-around time: two to three business days usually (P.R.Chinese)
-
Data reported electronically via e-mail
Files delieved: ABI Electropherogram and Simple Text
How to Order Sequencing Services
For single order, you need to fill the Sequencing Sample Order Form here
print out the order form, send us a copy of the form together with your samples, and at the same time send us an E-mail with order form attached (electronic copy).
For orders located in ShangHai , if you have more than 20 samples per day, we can arrange a pick-up service for you, please call us at +86-21-64858434 .
For bulk orders and contract services, quotations may be needed The price per reaction is negotiable
-
Sequencing Sample Order Form
Primers Used for Sequencing
-
Universal and often-used primers , provided without extra charge in RealGene Sequencing Lab.
Primers not on the list or gene specific primers (GSP) should be prepared by customers and submitted together with sequencing samples. Required concentration and amount of submitted Primers.
Concentration |
Amount |
10 uMole, or 40-50ng/ul |
5 ul per reaction (2ul will be used in labeling) |
Table: Ready4U Primers*
Primer Names |
Oligo DNA Sequences (from 5' to 3' ) |
Bluescript KS |
TCGAGGTCGACGGTATC |
| Bluescript SK |
CGCTCTAGAACTAGTGGATC |
| M13 Forward (-20) |
GTAAAACGACGGCCAGTG |
| M13 Forward (-41) |
GGTTTTCCCAGTCACGAC |
| M13 Reverse (-27) |
GGAAACAGCTATGACCATG |
| M13 Reverse (-48) |
AGCGGATAACAATTTCACAC |
| pCDM8 Reverse |
TAAGGTTCCTTCACAAAG |
| pCEP Forward |
AGAGCTCGTTTAGTGAACCG |
| pCMV30, N-CMV30, for pFlag-CMV vect. |
AATGTCGTAATAACCCCGCCCC GTTGACGC |
| pCMV24, C-CMV24, for pFlag-CMV vect. |
TATTAGGACAAGGCTGGTGGG CAC |
| pCMV Forward |
CGCAAATGGGCGGTAGGCGTG |
| pGEX 5' |
GGGCTGGCAAGCCACGTTTGGTG |
| pGEX 3' |
CCGGGAGCTGCATGTGTCAGAGG |
| pTRE 3' |
CCACACCTCCCCCTGAAC |
| pTRE 5' |
CGCCTGGAGACGCCATCC |
| pYESTrp Forward |
GATGTTAACGATACCAGCC |
| pYESTrp Reverse |
GCGTGAATGTAAGCGTGAC |
| SP6 |
TACGATTTAGGTGACACTATAG |
| T3 |
CAATTAACCCTCACTAAAGG |
| T7 |
GTAATACGACTCACTATAGGG |
| T7 Reverse, or T7T |
GCTAGTTATTGCTCAGCGG |
More primers will be added to this list, please check this website frequently
Technical supports for sample preparation and submission
General Information to submit your sequencing samples
We prefer your samples in 0.2 ml 8-strip PCR tubes, 96-well PCR plates with 8- or 12-strip caps. You also can use common Eppondorf tubes. The template DNA should be dissolved in 10 mM Tris-cl buffer, pH 8.5 (no EDTA!). H2O dissolved DNAs may not be kept longer.
.
Generally, The DNA template submitted to us is a doubled amount compared to that needed by one sequencing reaction. For plasmids, 12ul (100-160ng/ul), and for PCR products, 12ul (20-50ng/ul, depending on fragment sizes). See table bellow.
Please label your tube on the SIDE with the corresponding sample ID and fill your Sequencing Sample Order Form
( MS Excel format ). Cap your tubes tightly with matching caps. Try to provide some cushion
-
around the tubes to avoid any potential damaging during shipping. Send your tubes to us by express mail carriers (Fedex is preferred). Please check Priority Overnight option for timely delivery.
As a reference, the amount of template needed per reaction, please refer to the following table:
DNAs (Vectors or Fragments) |
DNA Size |
Amount Used Per Reaction |
Concentration and Amount Submitted |
Double Strand plasmid |
3-7 kb |
0.6-1.2 ug |
100-200ng/ul, 12ul |
Double Strand plasmid |
>7 kb |
1.0-2.0 ug |
200-300ng/ul, 12ul |
Single Strand plasmid |
|
300-500 ng |
50-100ng/ul, 12ul |
Bac, Pac or cosmid |
|
2.0-4.0 ug |
0.6-0.8 ug/ul, 12ul |
Genomic DNAs |
|
4.0-6.0 ug |
0.8-1.0 ug/ul, 12ul |
PCR product |
< 100bp |
60 ng |
10-20ng/ul, 12ul |
PCR product |
100-500bp |
60-100 ng |
10-20ng/ul, 12ul |
PCR product |
500-1000bp |
100-200 ng |
20-40ng/ul, 12ul |
PCR product |
>1000bp |
200-500 ng |
40-60ng/ul, 12ul |
-
For Plasmid DNAs
Because most labs use automated plasmid extration machines to make mini-preparations of plasmids, or use the plasmid mini-prep Kits to manually purify plasmids, it has simplified the sequencing sample submission. We make following suggestions for you:
1.Culture a single colony in 3-4ml LB medium with appropriate antibiotics overnight (12 hours, never over 16 hours, The genomic DNA released by dead bacteria may significantly affect the sequencing reaction). Pellet all the bacteria for plasmid extraction;
2.Purify plasmid DNA by QIAGEN Mini-prep Kit, and final elution volume is about 40-50ul;
3.Submit 12ul (about 200ng/ul) of plasmid solution for each sequencing reaction;
4.Submit 5ul of primer x (20ng/ul) each reaction if the primer is not on our Ready4U primer list;
5.Shipping via Fedex overnight delivery
.For Plasmid DNAs For DNAs from PCR products
PCR products as templates should be purified using a method that eliminates primers, nucleotides, and extraneous bands. Usually, agarose gel fractionation plus gel extraction kit purification are enough. We suggest you use QIAGEN Quick PCR Preps Kit for primer removal if your product shows only one sharp specific band. After purification, it is important that you verify the presence of only a single PCR product band on a gel.
Accurate quantification of template concentration is especially important for sequencing PCR products. Absorbance on a spectrophotometer at 260nm may not give you an accurate measurement of DNA concentration. We recommend running the sample alongside a DNA Molecular Weight Marker of known concentration on an agarose gel to estimate the sample amount. Lambda DNA MW Marker digested with Eco RI and Hind III is usually used in labs as sample quantification estimation, which has a MW nearly 50kb. If you load 500ng of the MW marker, the amount of 1kb DNA band is around 10ng.
We can process samples submitted in all common size microtubes, although we prefer that samples be submitted in 0.2 ml tubes or 96-well plates designed for PCR with caps. Please don't send samples in regular microtiter plates (i.e.,those designed for immunoassays). Those plates are brittle and sometimes crack during shipment, resulting in sample loss.)
Favorgen provides High Quality , low cost and Fast Turnaround sequencing service.
|